Print This Page

February 20, 2015

Thailand

A New PCR Test for AHPND

 

Background

 

The AP3 method for detection of the small AHPND toxin gene (AHPND ToxA) released at the NACA website in June 2014 (A new and improved PCR method for detection of AHPND bacteria) has proven effective for detection of bacteria that cause acute hepatopancreatic necrosis disease (AHPND), but it has the disadvantage in being a 1-step PCR method that lacks the sensitivity to detect very low levels of AHPND bacteria.  It could not be adapted into an effective nested PCR method.  Thus, the method required a bacterial pre-enrichment culture step prior to DNA extraction and PCR testing for such samples.

 

To overcome this problem of relatively low sensitivity (approx. 10 pg bacterial DNA) and need for enrichment culture, we have developed a new two-step (nested-PCR) method called AP4 for detection of AHPND-bacteria with higher sensitivity (approx. 100 fg bacterial DNA).  This method targets a 1269 bp portion of the AHPND toxin plasmid sequence that includes the full ToxAgene plus a large portion of the ToxB gene sequence.

 

In purified form, the Pir-like toxins(ToxA and ToxB)work together to cause the hepatopancreatic necrosis characteristic of AHPND {Sirikharin, 2015 #8283}.  The toxin genes are located very close together (separated by 12 bp) on a plasmid (VpA1) of approximately 69 kbp that is carried by isolates of Vibrio parahaemolyticus that cause AHPND (VPAHPND) {Yang, 2014 #8265}.  The AP4 target sequence consists of a chimeric DNA fragment comprising the full ToxA gene sequence plus the 12 bp linker plus 70% of the succeeding ToxB gene sequence for a total of 1269 bp out of the whole ToxA and ToxB region (1665 bp) on the 69 kbp VpA1 plasmid (Fig. 1).  For the first-step PCR reaction, the outer primers AP4-F1 and AP4-R1(Fig. 1, bold underlined text) target a 1269 bp portion of the region that includes the full ToxA gene and a large portion of the ToxB gene sequence (921/1317 bp = 70%).  The AP4-F1 primer is equal to the AP3-Fprimer of the AP3 method.  For the second-step PCR reaction, a portion of the final solution from the first-step PCR reaction is used as the template with the inner (nested) primers AP4-F2 and AP4-R2 (Fig. 1, text in grey outline).  The target is a 230 bp portion of the sequence that includes 209 bp of the ToxA gene sequence plus the 12 bp spacer sequence plus 9 bp of the succeeding ToxB gene sequence.  At high concentrations of target DNA, additional, bands for amplicons may occur as the product of residual primer AP4-F1 working with AP4-R2 (357 bp) or AP4-F2 with AP4-R1 (1142 bp) in the nested step.

 

The advantage of the AP4 method over the AP3 method is that the it has 100 times higher sensitivity than the AP3 method.  Because of its higher sensitivity, the bacterial culture enrichment step needed when using the AP3 with low levels of AHPND bacteria may be omitted.  However, the AP4 method should not be considered as a replacement for the AP3 method but simply as an alternative choice for the users to choose should they need a more sensitive detection method.

 

The AP4 method has been tested with the same 104 bacterial isolates that were used for validating the AP3 detection method, and the results were identical, i.e., 100% specificity and sensitivity with the 104 isolates but at 100x lower template levels.

 

As with the previous announcements in this series, the AP4 method is provided for free use in the detection of AHPND bacteria.  A positive control plasmid for the AP4 method will be sent out to those who are already on our mailing list as recipients of plasmids for our previous AP methods to detect AHPND bacteria.  For those not already on our list, the plasmid will also be provided upon request to:  Dr. Kallaya Sritunyalucksana (kallaya@biotec.or.th).

 

 

Details of the PCR method

 

PCR Primers

Primers

5’-3’

Length

%GC

Tm

Ta

Expected

Amplicon

AP4-F1 (= AP3-F)*

ATGAGTAACAATATAAAACATGAAAC

26

23

49

55

1269 bp

AP4-R1

ACGATTTCGACGTTCCCCAA

20

50

52

AP4-F2

TTGAGAATACGGGACGTGGG

20

55

54

55

230 bp

AP4-R2

GTTAGTCATGTGAGCACCTTC

21

48

52

*Please note that primer AP4 F1 is identical to primer AP3-F from the AP3 method.

 

First PCR Reaction Conditions

Components

µl

Final Conc.

 

Protocol

10x PCR mix (Invitrogen)

2.5

1X

 

Denature

94°C, 2 min

50 mM MgCl2

1.5

3 mM

 

30 cycles

10 mM dNTPs

0.5

0.2 mM

 

Denature

94°C, 30 sec

10 µM AP4-F1

0.5

0.2 μM

 

Annealing

55°C, 30 sec

10 µM AP4-R1

0.5

0.2 μM

 

Extension

72°C, 90 sec

5U/μlTaq DNA polymerase

0.3

1.5 U

 

Final

72°C, 2 min

DNA template (50 ng/ μl)

2.0

 

 

 

 

Sterile water

17.2

 

 

 Primers

 

Total

25.0

 

 

 

 

 

 

2nd (Nested) PCR Reaction Conditions

Components

µl

 

Final conc.

 

Protocol

10x PCR mix (Invitrogen)

2.5

 

1X

 

Denature

94°C, 2 min

50 mM MgCl2

1.5

 

3 mM

 

25 cycles

10 mM dNTPs

0.5

 

0.2 mM

 

Denature

94°C, 20 sec

10 µM AP4-F2

0.375

 

0.15 μM

 

Annealing

55°C, 20 sec

10 µM AP4-R2

0.375

 

0.15 μM

 

Extension

72°C, 20 sec

5U/μlTaq DNA polymerase

0.3

 

1.5 U

 

Final

72°C, 2 min

First PCR product

2.0

 

 

 

 

 

Sterile water

17.45

 

 

 

 

 

Total

25.0

 

 

 

 

 

 

 

Figure 1. Diagram of the target sequences for the AP4 primers on the VpA1 plasmid in the region of the total nucleic acid sequence of the AHPND ToxA and ToxB genes plus the 12 nucleic acid spacer that links them together (spacer underlined text in grey background, i.e., included in the AP4-R2 primer)(total length 1665 bp of the fragment).  The outer primers AP4-F1 and AP4-R1(bold underlined text) target a 1269 bp portion of the sequence that includes the full ToxAgene sequence and a large portion of the ToxB gene sequence (921/1317 bp = 70%).  The inner (nested) primers AP4-F2 and AP4-R2 (text in grey outline) target a 230 bp portion of the sequence that includes 209 bp of the ToxA gene sequence plus the 12 bp spacer sequence and 9 bp of the succeeding ToxB gene sequence.

 

Shrimp News: To keep the following sequence from making this webpage impossible wide, I placed carriage returns at the end of each line of the following sequence.  For a true representation of the sequence, remove the carriage returns.

 

ATGAGTAACAATATAAAACATGAAACTGACTATTCTCACGATTGGACTGTC

GAACCAAACGGAGGCGTCACAGAAGTAGACAGCAAACATACACCTATCATC

CCGGAAGTCGGTCGTAGTGTAGACATTGAGAATACGGGACGTGGGGAGCTT

ACCATTCAATACCAATGGGGTGCGCCATTTATGGCTGGCGGCTGGAAAGTG

GCTAAATCACATGTGGTACAACGTGATGAAACTTACCATTTACAACGCCCT

GATAATGCATTCTATCATCAGCGTATTGTTGTAATTAACAATGGCGCTAGT

CGTGGTTTCTGTACAATCTATTACCACTAAGAAGGTGCTCACATGACTAAC

GAATACGTTGTAACAATGTCATCTTTGACGGAATTTAACCCTAACAATGCT

CGTAAAAGTTATTTATTTGATAACTATGAAGTTGATCCTAACTATGCTTTC

AAAGCAATGGTTTCATTTGGTCTTTCAAATATTCCTTACGCGGGTGGTTTT

TTATCAACGTTATGGAATATCTTTTGGCCAAATACGCCAAATGAGCCAGAT

ATTGAAAACATTTGGGAACAATTACGTGACAGAATCCAAGATTTAGTAGAT

GAATCGATTATAGATGCCATCAATGGAATATTGGATAGCAAAATCAAAGAG

ACACGCGATAAAATTCAAGACATTAATGAGACTATCGAAAACTTCGGTTAT

GCTGCGGCAAAAGATGATTACATTGGTTTAGTTACTCATTACTTGATTGGA

CTTGAAGAGAACTTTAAGCGCGAGCTAGACGGTGATGAATGGCTTGGTTAT

GCGATATTGCCTCTATTAGCAACAACTGTAAGTCTTCAAATTACTTACATG

GCTTGTGGTCTGGATTATAAGGATGAATTCGGTTTCACCGATTCTGATGTG

CATAAGCTAACACGTAATATTGATAAGCTTTATGATGATGTATCGTCTTAC

ATTACAGAACTCGCTGCGTGGGCTGATAACGACTCTTACAATAATGCAAAC

CAAGATAACGTGTATGATGAAGTGATGGGTGCTCGTAGTTGGTGTACGGTT

CACGGCTTTGAACATATGCTTATTTGGCAAAAAATCAAAGAGTTGAAAAAA

GTTGATGTGTTTGTTCACAGTAATTTAATTTCATATTCACCTGCTGTTGGT

TTTCCTAGTGGTAATTTCAACTATATTGCTACAGGTACGGAAGATGAAATA

CCTCAACCATTAAAACCAAATATGTTTGGGGAACGTCGAAATCGTATTGTA

AAAATTGAATCATGGAACAGTATTGAAATACATTATTACAATCGCGTAGGT

CGACTTAAACTAACTTATGAAAATGGGGAAGTGGTAGAACTAGGCAAGGCT

CATAAATATGACGAGCATTACCAATCTATTGAGTTAAACGGCGCTTACATT

AAATATGTTGATGTTATTGCCAATGGACCTGAAGCAATTGATCGAATCGTA

TTTCATTTTTCAGATGATCGAACATTTGTTGTTGGTGAAAACTCAGGCAAG

CCAAGTGTGCGTTTGCAACTGGAAGGTCATTTTATTTGTGGCATGCTTGCG

GATCAAGAAGGTTCTGACAAAGTTGCCGCGTTTAGCGTGGCTTATGAATTG

TTTCATCCCGATGAATTTGGTACAGAAAAGTAG

 

 

Acknowledgements

 

The AP4 PCR method was developed entirely by Thai scientists working in Thailand at Centex Shrimp,the Shrimp-virus interaction laboratory, BIOTEC and Aquatic Animal Health Research Center and Charoen Pokphand Co. Ltd.  It was also supported entirely by research funding from Thailand.  We would like to acknowledge the support and encouragement for our research on AHPND from the Agriculture Research and Development Agency, the National Research Council of Thailand, the Thai Commission for Higher Education, Mahidol University, Faculty of Marine Technology at Burapha University, the National Science and Technology Development Agency, the Patani Shrimp Farmers Club, the Surathani Shrimp Farmers Club, the Thai Frozen Foods Association, Charoen Pokphand Company, SyAqua Co. Ltd., and Thai Union Co., Ltd.

 

Information: Professor T.W. Flegel, Chalermprakiat Building, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand (phone  +662-201-5870, fax +662-247 -051, mobile +6681-403-5833, email tim.flegel@gmail.com, webpage http://www.mahidol.ac.th/en/).

 

Source 1. A Two-Tube, Nested PCR Detection Method for AHPND Bacteria.  Kallaya Sritunyalucksana1,2,Sirintip Dangtip3, Piyachat Sanguanrut2, Ratchanok Sirikharin1,2, Suparat Taengchaiyaphum1,Siripong Thitamadee2, Rapeepat Mavichak4, Porranee Proespraiwong4, Timothy W. Flegel2,5.  February 20, 2015.

 

1Shrimp-virus Interaction Laboratory (ASVI), National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Rama VI Rd., Bangkok, Thailand

 

2Centex Shrimp and Department of Biotechnology, Faculty of Science, Mahidol University, RamaVI Rd., Bangkok, Thailand

 

3Aquaculture Product Development and Services Laboratory (AAPS), National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Pathumthani, 12120, Thailand

 

4Aquatic Animal Health Research Center, Charoen Pokphand Co. Ltd., Rama 2 Rd., Km 41.5, T. Bangtorat, A. MuangSamutsakorn, Samutsakorn 74000, Thailand,

 

5National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Pathumthani, 12120, Thailand

 

Sources: 1. Email to Shrimp News International.  A Nested PCR Method for AHPND Bacteria.  Professor T.W. Flegel.  February 20, 2015. 2. Bob Rosenberry, Shrimp News International, February 20, 2015.

Print This Page